View source for Xanthomonas campestris pv. pelargonii

<btaxobox imgnum= 5336072/>
'''<big>Author: [[User:jbonkowski|John Bonkowski]], Bacheline Joseph, Deanna Bayo, University of Florida</big>'''

'''Reviewed by:Name, Organization'''
=Pathogen=
'' Xanthomonas campestris'' pv. ''pelargonii '' is a gram negative, rod-shaped, obligately aerobic, bacterium that produces yellow colored colonies when isolated on nutrient agar. This bacterium is the causal agent of bacterial blight on plants in the genera Pelargonium and Geranium (1).

=Symptoms and Signs=
Symptoms can vary depending on the growing conditions and individual cultivar and species affected. Initial symptoms include small water soaked spots that can be seen from the underside of the leaf and become visible from the upper surface of the leaf after a few days. Eventually, these spots will turn tan to brown and will be sunken with well-defined margins. Wedge-shaped areas of chlorosis and necrosis may develop with the point starting at the leaf spot and extend to the leaf margins. The bacterium usually travels from the leaf spots to the vascular system and causes a systemic wilt (1). This can kill individual leaves and in severe cases it may kill the entire plant. Leaves will first droop, become chlorotic, and then die and fall off. The stems over time will turn black. If a stem is cut from the plant that is infected, bacteria may ooze from the vascular system (2). Once systemic vascular wilt is evident, the bacterium can cause a root rot as it travels down the plant to the roots. Plants infected as cuttings will rot at the base of the cutting and fail to produce roots (1).

<bgallery collection=88866/>

=Ecology and Spread=
Symptom development can occur seven days or more after infection. Disease development is favored around 27° C. At temperatures below 10 °C or above 32° C, disease development is suppressed (1). In cooler temperatures, symptoms may be masked and will not develop until warmer temperatures are achieved (3). Mature and woodier plants seem less susceptible to this disease. However, they can still carry the bacterium and transfer it to daughter plants produced from cuttings without showing any outward symptoms typical of infection. Latent infections are also especially important when propagating plant material through cuttings. After moving new stock, cuttings may rot at the base and eventually completely die (1). The bacteria can be spread on knives, in propagation medium, and by water splashing from infected leaves to uninfected plants, thus overhead irrigation should be avoided (2). It is possible that ''Xanthomonas campestris'' pv. ''pelargonii'' can survive in the soil for at least a year in plant tissue, but cannot survive in the absence of host debris (1).

=Geographic Distribution=




=Management=
Management of any pathogen is often dependent upon both cultural and chemical options.  Consult your local extension specialist or agent for recommendations relevant to your particular host and state.  Remember: the label is the law.

=Diagnostic Procedures=
{|class='wikitable'
!Procedures/Media
!Result for ''Xanthomonas campestris'' pv. ''pelargonii ''
|-
|[[KOH test]]
|Positive; stringing is observed (Gram-negative)
|-
|[[Oxidase test|Oxidase]]
|Negative; no color change
|-
|[[Urease production|Urease]]
|Negative; no color change
|-
|[[King's medium B]]
|Negative; nonfluorescent
|-
|[[Nutrient agar]]
|Yellow colonies
|-
|[[Yeast extract dextrose|Yeast extract-dextrose CaCO3 medium]]
|Yellow to orange mucoid colonies
|-
|[[Sucrose peptone agar]]
|Positive; colonies are mucoid
|-
|[[Hypersensitivity Reaction (HR)|Hypersensitive Response]]
|Tomato: Positive; necrotic area
|-
|
|Tobacco: Positive; necrotic area
|-
|[[Miller-Schroth medium]]
|No growth
|-
|[[Crystal violet pectin|Crystal violet pectate medium]]
|Negative; no pitting is observed
|-
|[[Aerobe-anaerobe test]]
|Aerobic; medium is cloudy only near the top
|}

Polymerase chain reaction is an effective way to identify this pathogen. 

'''PCR'''

A nonspecific xanthomonad primer set may be used to identify the presence of multiple ''Xanthomonas'' spp. in plant material. The following sequences may be used:
RS21: (5’GCACGCTCCAGATCAGCATCGAGG3’)
RS22: (5’GGCATCTGCATGCGTGCTCTCCGA3’) … Expected bp size = 1075

: Leite, R. P., Jr., G. V. Minsavage, U. Bonas, and R. E. Stall. 1994. Detection and identification of phytopathogenic  ''Xanthomonas'' strains by amplification of DNA sequences related to hrp genes of ''Xanthomonas campestris'' pv. ''vesicatoria''. Appl. Env. Microbiol. 60:1068-1077.

=Selected References=
1. Daughtrey, M. L., Wick, R. L., and Peterson, J. L.  2006. Compendium of Flowering Potted Plants. The American Phytopathological Society, St. Paul, MN. 55-56.

2. Gary W. Moorman. Bacterial Blight of Geraniums. Penn State Extension. Penn State College of Agricultural Sciences. Online: http://extension.psu.edu/pests/plant-diseases/all-fact-sheets/bacterial-blight-of-geraniums.

3. Kado, C. I. 2010. Plant Bacteriology. American Phytopathologica Society, St. Paul, MN. 222.

=Resources and References=

=Acknowledgements=
{{SouthernDiagnosticResources‎}}
[[Category:Diagnostic Resources]]