Xanthomonas campestris pv vesicatoria

From Bugwoodwiki
                       Card image cap
Taxonomy
DomainBacteria
PhylumProteobacteria
ClassGammaproteobacteria
OrderXanthomonadales
FamilyXanthomonadaceae
GenusXanthomonas
Scientific Name
Xanthomonas vesicatoria
Scientific Name Synonyms
Xanthomonas campestris pv. vesicatoria
Xanthomonas vesicatoria pv. vesicatoria
Xanthomonas axonopodis pv. vesicatoria
Phytomonas vesicatoria
Common Name
bacterial spot

Author: John Bonkowski, Bacheline Joseph, Deanna Bayo, University of Florida

Reviewed by:Name, Organization

Pathogen

Xanthomonas campestris pv. vesicatoria (synonym: Xanthomonas euvesicatoria and Xanthomonas perforans) is a gram negative, aerobic, rod-shaped bacterium 0.7 to 1.0 x 2.0 to 2.4 µm in size that causes leaf and fruit spots on peppers and tomatoes (1, 3). This bacterium has been separated into three pathotypes that differ in physiological traits (1).

Note: Xanthomonas perforans has never been isolated from pepper hosts, but Xanthomonas euvesicatoria has been isolated from both tomato and pepper hosts (4).

Symptoms and Signs

Under wet conditions, leaves, stems, and fruits of pepper hosts will develop lesions that appear water soaked. Early leaf lesions start as small, brown spots that become sunken with necrotic centers. Spots generally do not enlarge more than 3 mm in diameter (5) and are delineated by veins, potentially giving them an angular appearance (6). Spots may coalesce into larger blighted areas if conditions are conducive for disease development. Leaves may also turn yellow and drop prematurely. Fruit lesions start as green spots that become scabby blisters with age (5, 6). After premature defoliation, fruit may develop sunscald due to canopy thinning. Major crop losses are primarily caused by: 1) blossom and fruit drop; and 2) fruit deformation due to lesions (primarily a quality issue) and sunscald (6).

Tomato plants affected by this bacterium share similar symptoms on the leaves and fruit. Coalescing spots form dark streaks on the leaflets, inducing leaf blighting and epinasty. Unlike in peppers, it is more common to see dead or affected foliage remain on the plant, causing it to appear burned or scorched. Tomato fruit symptoms form as tiny, raised blisters which increase in size over time. The scabby blisters are characterized by having raised margins and a sunken middle surrounded by an ephemeral halo (3).

5402922
5402921
5384509
5384505
5384507
5384508
5362699
5362922
5368904
5384510


Ecology and Spread

Warm temperatures (24 to 30°C) with plenty of rain or high relative humidity favor disease development. The initial introduction of the pathogen in the field is typically by seeds or transplants grown from infected seeds or cuttings. Wind-driven rain will cause further spread within fields. Wind-driven sand, insect feeding, or other mechanical damage may facilitate infections. If no wound is present, the bacterium can enter via stomata and other natural openings (5, 3).

Pepper and tomato volunteers and plant debris found in the field play a role in harboring the bacteria during times not suitable for the bacteria’s growth (3, 5, 6). Bacteria can also live epiphytically on weeds nearby, but this is thought to be a minor role for inoculum retention. It is also possible for bacteria to spread via rain and irrigation, especially in greenhouse production (1, 6). Greater disease development is observed when infection occurs early and where overhead irrigation is implemented (6).

Geographic Distribution

Europe

Egypt, Greece, Hungary, Israel, Italy, Romania, Russia, Yugoslavia, Austria, Belarus, Bulgaria, Czech Republic, France, Morocco, Poland, Slovakia, Slovenia, Spain, Switzerland, Tunisia, Turkey.

Asia

China, India , Israel, Japan , Korea Democratic People's Republic, Korea Republic, Pakistan, Philippines, Russia, Taiwan, Thailand, Turkey.

Africa

Egypt, Ethiopia, Kenya, Malawi, Morocco, Mozambique, Niger, Nigeria, Réunion, Senegal, Seychelles, South Africa, Sudan, Togo, Tunisia, Zambia, Zimbabwe.

North America

Bermuda, Canada, Mexico, United States of America.

Central America and Caribbean

Barbados, Costa Rica, Cuba, Dominica, Dominican Republic, El Salvador, Guadeloupe, Guatemala, Honduras, Jamaica, Martinique, Nicaragua, Puerto Rico, St. Kitts and Nevis, St. Vincent and Grenadines, Trinidad and Tobago, United States Virgin Islands.

South America

Argentina, Brazil, Chile, Colombia, Paraguay, Suriname, Uruguay, Venezuela.

Oceania

Australia, Fiji, Micronesia, New Zealand, Palau, Tonga (1).

Management

Management of any pathogen is often dependent upon both cultural and chemical options. Consult your local extension specialist or agent for recommendations relevant to your particular host and state. Remember: the label is the law.

Diagnostic Procedures

Procedures/Media Result for Xanthomonas campestris pv. vesicatoria
KOH test Positive; stringing can be observed (Gram-negative)
Oxidase Negative; no color change
Urease Negative; no color change
Kings medium B Negative; nonfluorescent
Nutrient agar Yellow colonies
Yeast extract-dextrose CaCO3 medium Yellow to orange mucoid colonies
Sucrose peptone agar Positive; colonies are mucoid
Hypersensitive Response Tomato: Positive; necrotic area
Tobacco: Positive; necrotic area
Miller-Schroth medium No growth
Crystal violet pectate medium Negative; no pitting is observed
Aerobe-anaerobe test Aerobic; medium is cloudy only near the top

Polymerase chain reaction is an effective way to identify this pathogen.

PCR

A nonspecific xanthomonad primer set may be used to identify the presence of multiple Xanthomonas spp. in plant material. The following sequences may be used: RS21: (5’GCACGCTCCAGATCAGCATCGAGG3’) RS22: (5’GGCATCTGCATGCGTGCTCTCCGA3’) … Expected bp size = 1075

Leite, R. P., Jr., G. V. Minsavage, U. Bonas, and R. E. Stall. 1994. Detection and identification of phytopathogenic Xanthomonas strains by amplification of DNA sequences related to hrp genes of Xanthomonas campestris pv. vesicatoria. Appl. Env. Microbiol. 60:1068-1077.

Selected References

1. CABI and EPPO. “Data Sheet on Quarantine Pest – Xanthomonas vesicatoria” European Plant Protection Organization. Online: https://www.eppo.int/QUARANTINE/bacteria/Xanthomonas_vesicatoria/XANTVE_ds.pdf.

2. Euzeby, Jean. 2006. Validation list no. 109. International Journal of Systematic and Evolutionary Microbiology 56:925–927.

3. Jones, J. B. 1991. Compendium of Tomato Diseases. American Phytopathological Society, St. Paul, MN. 27.

4. Jones, J. B., Lacy, G. H., Bouzar, H., Stall, R. E., Schaad, N. W. 2004. Reclassification of the Xanthomonads Associated with Bacterial Spot Disease of Tomato and Pepper. Systemic and Applied Microbiology 27:755-762.

5. Jones, J. B., Pernezny, K. 2003. Compendium of Pepper Diseases. American Phytopathological Society, St. Paul, MN. 6-7.

6. Ritchie, D.F. 2000. Bacterial spot of pepper and tomato. The Plant Health Instructor. Online publication. doi: 10.1094/PHI-I-2000-1027-01.

Resources and References

Acknowledgments