Taxonomy

Domain	Bacteria
Phylum	Proteobacteria
Class	Gammaproteobacteria
Order	Xanthomonadales
Family	Xanthomonadaceae
Genus	Xanthomonas
Species	Xanthomonas hortorum

Scientific Name

Xanthomonas hortorum pv. pelargonii

Scientific Name Synonyms

Xanthomonas campestris pv. pelargonii

Common Name

bacterial blight of geranium

Author: John Bonkowski, Bacheline Joseph, Deanna Bayo, University of Florida

Reviewed by:Name, Organization

Pathogen

Xanthomonas campestris pv. pelargonii is a gram negative, rod-shaped, obligately aerobic, bacterium that produces yellow colored colonies when isolated on nutrient agar. This bacterium is the causal agent of bacterial blight on plants in the genera Pelargonium and Geranium (1).

Symptoms and Signs

Symptoms can vary depending on the growing conditions and individual cultivar and species affected. Initial symptoms include small water soaked spots that can be seen from the underside of the leaf and become visible from the upper surface of the leaf after a few days. Eventually, these spots will turn tan to brown and will be sunken with well-defined margins. Wedge-shaped areas of chlorosis and necrosis may develop with the point starting at the leaf spot and extend to the leaf margins. The bacterium usually travels from the leaf spots to the vascular system and causes a systemic wilt (1). This can kill individual leaves and in severe cases it may kill the entire plant. Leaves will first droop, become chlorotic, and then die and fall off. The stems over time will turn black. If a stem is cut from the plant that is infected, bacteria may ooze from the vascular system (2). Once systemic vascular wilt is evident, the bacterium can cause a root rot as it travels down the plant to the roots. Plants infected as cuttings will rot at the base of the cutting and fail to produce roots (1).

Ecology and Spread

Symptom development can occur seven days or more after infection. Disease development is favored around 27° C. At temperatures below 10 °C or above 32° C, disease development is suppressed (1). In cooler temperatures, symptoms may be masked and will not develop until warmer temperatures are achieved (3). Mature and woodier plants seem less susceptible to this disease. However, they can still carry the bacterium and transfer it to daughter plants produced from cuttings without showing any outward symptoms typical of infection. Latent infections are also especially important when propagating plant material through cuttings. After moving new stock, cuttings may rot at the base and eventually completely die (1). The bacteria can be spread on knives, in propagation medium, and by water splashing from infected leaves to uninfected plants, thus overhead irrigation should be avoided (2). It is possible that Xanthomonas campestris pv. pelargonii can survive in the soil for at least a year in plant tissue, but cannot survive in the absence of host debris (1).

Geographic Distribution

Management

Management of any pathogen is often dependent upon both cultural and chemical options. Consult your local extension specialist or agent for recommendations relevant to your particular host and state. Remember: the label is the law.

Diagnostic Procedures

Procedures/Media	Result for Xanthomonas campestris pv. pelargonii
KOH test	Positive; stringing is observed (Gram-negative)
Oxidase	Negative; no color change
Urease	Negative; no color change
Kings medium B	Negative; nonfluorescent
Nutrient agar	Yellow colonies
Yeast extract-dextrose CaCO3 medium	Yellow to orange mucoid colonies
Sucrose peptone agar	Positive; colonies are mucoid
Hypersensitive Response	Tomato: Positive; necrotic area
	Tobacco: Positive; necrotic area
Miller-Schroth medium	No growth
Crystal violet pectate medium	Negative; no pitting is observed
Aerobe-anaerobe test	Aerobic; medium is cloudy only near the top

Polymerase chain reaction is an effective way to identify this pathogen.

PCR

A nonspecific xanthomonad primer set may be used to identify the presence of multiple Xanthomonas spp. in plant material. The following sequences may be used: RS21: (5’GCACGCTCCAGATCAGCATCGAGG3’) RS22: (5’GGCATCTGCATGCGTGCTCTCCGA3’) … Expected bp size = 1075

Leite, R. P., Jr., G. V. Minsavage, U. Bonas, and R. E. Stall. 1994. Detection and identification of phytopathogenic Xanthomonas strains by amplification of DNA sequences related to hrp genes of Xanthomonas campestris pv. vesicatoria. Appl. Env. Microbiol. 60:1068-1077.

Selected References

1. Daughtrey, M. L., Wick, R. L., and Peterson, J. L. 2006. Compendium of Flowering Potted Plants. The American Phytopathological Society, St. Paul, MN. 55-56.

2. Gary W. Moorman. Bacterial Blight of Geraniums. Penn State Extension. Penn State College of Agricultural Sciences. Online: http://extension.psu.edu/pests/plant-diseases/all-fact-sheets/bacterial-blight-of-geraniums.

3. Kado, C. I. 2010. Plant Bacteriology. American Phytopathologica Society, St. Paul, MN. 222.

Resources and References

Acknowledgements

National Institute of Food and Agriculture, U.S. Department of Agriculture, under Agreement No. 2011-41530-30708 as part of "Diagnostic Image Series Development for Supporting IPM in the Southern Region" (USDA-NIFA-RIPM-003351)