Xanthomonas axonopodis pv. citri

Taxonomy

Domain	Bacteria
Phylum	Proteobacteria
Class	Gammaproteobacteria
Order	Xanthomonadales
Family	Xanthomonadaceae
Genus	Xanthomonas

Scientific Name

Xanthomonas citri

Scientific Name Synonyms

Xanthomonas campestris pv. citri

Pseudomonas citri

Common Name

citrus canker

Author: John Bonkowski, Bacheline Joseph, Deanna Bayo, University of Florida

Reviewed by:Name, Organization

Pathogen

Xanthomonas axonopodis pv. citric (synonym: Xanthomonas campestris pv. citri) is a gram negative, aerobic, rod-shaped bacterium that causes citrus canker. This pathogen generally causes leaf-spotting and fruit rind-blemishing disease. Highly favorable conditions can lead to more severe infections that result in shoot dieback and fruit drop. Citrus canker can cause major economic losses due to defoliation, fruit drop, and reduced marketability of mature, symptomatic fruit (2).

Symptoms and Signs

Initial symptoms are lesions, the size of a pinpoint that can grow to about 2 to 10 mm in diameter. Lesions develop on the leaves, stems, and fruit that may grow into irregular shapes. Leaf lesions are raised pustules with a distinctive chlorotic halo that start on the underside of the leaves and may develop on the upper surface. As the lesions age, they will appear corky with gray sunken centers surrounded by raised brown margins. The spots will coalesce into larger aggregated areas that tend to form on the leaf tips and margins. Growth patterns on the leaves also follow along leafminer galleries. Lesions on the stems and fruits are similar to the leaves, but the lesion can extend up to 1 mm into the plant tissue (2).

Ecology and Spread

Dispersal in the field is primarily by wind-driven rain. Thorns, insects, and sand can cause wounds that invite bacterial growth. Asian leaf miners (Phyllocnistis citronella) are commonly associated with citrus canker. Leafminers facilitate infection by creating large internal wounds within leaves and spreading the bacteria within these mines. Pruning tools, worker activities, and spray equipment can also help spread the pathogen. Citrus canker is known spread over long distances by: 1) hurricanes, tropical storms, and tornados; 2) shipment of diseased budwood, rootstocks, or budded trees; or 3) movement of wooden harvesting boxes containing infected fruit and leaves (2).

Infection by this pathogen can be a serious threat in areas that experience high rainfall and warm temperatures during periods of shoot emergence and early fruit development. Young trees are particularly vulnerable as new leaves and stems are susceptible for up to six weeks. Fruits are susceptible for the first 90 days after the petals have fallen. Susceptibility of tissue decreases with age as the cuticle layers thicken. Vigorous rootstocks generally have more canker due to a greater number of new growth flushes per year (2). The pathogen is capable of surviving inside woody tissue for several years, but it may not survive very long epiphytically on the outside of plants or within the soil. Cull piles can also be a source of inoculum (1).

Geographic Distribution

Asia

Afghanistan, Bangladesh, Cambodia, China, Hong Kong, India, Indonesia, Iran, Iraq, Japan, Korea Democratic People's Republic, Korea Republic, Laos, Malaysia, Maldives, Myanmar, Nepal, Oman, Pakistan, Philippines, Saudi Arabia, Singapore, Sri Lanka, Taiwan, Thailand, United Arab Emirates, Viet Nam, Yemen.

Africa

Comoros, Ivory Coast, Gabon, Madagascar, Mauritius, Mozambique, Réunion, Seychelles, South Africa, Zaire.

North America

Mexico, United States of America (Florida, Alabama, Georgia, Louisiana, South Carolina, and Texas).

South America

Argentina, Brazil (Mato Grosso do Sul, Santa Catarina), Paraguay, Uruguay (Salto, Paysandu).

Oceania

Australia (Northern Territory, Christmas Island, Cocos Islands), Fiji, Guam, Northern Mariana Islands, Micronesia, New Zealand, Palau, Papua New Guinea (1).

Management

Management of any pathogen is often dependent upon both cultural and chemical options. Consult your local extension specialist or agent for recommendations relevant to your particular host and state. Remember: the label is the law.

Diagnostic Procedures

Procedures/Media	Result for Xanthomonas axonopodis pv. citri
Oxidase	Negative; no color change
Urease	Negative; no color change
Kings medium B	Negative; nonfluorescent
Nutrient agar	Yellow colonies
Yeast extract-dextrose CaCO3 medium	Yellow to orange mucoid colonies
Sucrose peptone agar	Positive; colonies are mucoid
Hypersensitive Response	Tomato: Positive; necrotic area
	Tobacco: Positive; necrotic area
Miller-Schroth medium	No growth
Crystal violet pectate medium	Negative; no pitting is observed
Aerobe-anaerobe test	Aerobic; medium is cloudy only near the top

Immunostrips and polymerase chain reaction are two effective ways to identify this pathogen.

Immunostrips

https://orders.agdia.com/InventoryD.asp?loc=IN&collection=ISK%2092200&attribute_Size=25

PCR

A nonspecific xanthomonad primer set may be used to identify the presence of multiple Xanthomonas spp. in plant material. The following sequences may be used: RS21: (5’GCACGCTCCAGATCAGCATCGAGG3’) RS22: (5’GGCATCTGCATGCGTGCTCTCCGA3’) … Expected bp size = 1075

Leite, R. P., Jr., G. V. Minsavage, U. Bonas, and R. E. Stall. 1994. Detection and identification of phytopathogenic Xanthomonas strains by amplification of DNA sequences related to hrp genes of Xanthomonas campestris pv. vesicatoria. Appl. Env. Microbiol. 60:1068-1077.

Selected References

1. CABI and EPPO. “Data Sheets on Quarantine Pest – Xanthomonas axonopodis pv. citri." European Plant Protection Organization. Online: https://www.eppo.int/QUARANTINE/bacteria/Xanthomonas_citri/XANTCI_ds.pdf

2. Gottwald, T.R., Graham, J. H. 2000. Compendium of Citrus Diseases. 2nd ed. American Phytopathological Society, St. Paul, MN. 5-7.

Acknowledgements

• National Institute of Food and Agriculture, U.S. Department of Agriculture, under Agreement No. 2011-41530-30708 as part of "Diagnostic Image Series Development for Supporting IPM in the Southern Region" (USDA-NIFA-RIPM-003351)